plko 1 shctrl puro Search Results


96
Addgene inc plko 1 puro control shctrl
Plko 1 Puro Control Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko 1 puro control shctrl/product/Addgene inc
Average 96 stars, based on 1 article reviews
plko 1 puro control shctrl - by Bioz Stars, 2026-06
96/100 stars
  Buy from Supplier

96
Addgene inc plko 1 shctrl puro
Plko 1 Shctrl Puro, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko 1 shctrl puro/product/Addgene inc
Average 96 stars, based on 1 article reviews
plko 1 shctrl puro - by Bioz Stars, 2026-06
96/100 stars
  Buy from Supplier

95
Addgene inc control shrna against luciferase shctrl
Validation of expression and tumorigenicity of hub genes. (A) qRT-PCR validation of MEP1A, CCL20, ADORA2B, TNFSF9, ICAM4, and SLC7A2 in HCC and normal plasmas. (B, C) The mRNA expression level of CCL20 and SLC7A2 in HCC cell lines (SMMC7721, Huh7, HepG2, and HCCLM3) and the normal liver cell lines (WLR68, and LO2) was indicated by qRT-PCR assays. (D) The protein and (E) mRNA expression of CCL20 and SLC7A2 was analyzed by western blotting and RT-PCR in stable SMMC-7721 cells expressing-shRNA against <t>luciferase</t> or CCL20 and over SLC7A2. (F) Morphology of HCC cells after knockdown of CCL20 and overexpression of SLC7A2. (G) Tumorigenicity of <t>SMMC7721-shCtrl</t> cells and SMMC7721-shCCL20/overSLC7A2 cells in nude mice. (H) Tumor volume was measured every 3 days after tumor formation in nude mice injected with SMMC7721 cells transfected with shCtrl or shCCL20/overSLC7A2. (I, J) Tumor weight was measured in nude mice injected with SMMC7721 cells transfected with shCtrl or shCCL20/overSLC7A2 after 30 days. *p < 0.05; **p < 0.01; ***p < 0.005; ****p < 0.0001, ns, not significant.
Control Shrna Against Luciferase Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/control shrna against luciferase shctrl/product/Addgene inc
Average 95 stars, based on 1 article reviews
control shrna against luciferase shctrl - by Bioz Stars, 2026-06
95/100 stars
  Buy from Supplier

93
Addgene inc plko 1 shctrl puro target sequence 5 cctaaggttaagtcgccctcg 3
Validation of expression and tumorigenicity of hub genes. (A) qRT-PCR validation of MEP1A, CCL20, ADORA2B, TNFSF9, ICAM4, and SLC7A2 in HCC and normal plasmas. (B, C) The mRNA expression level of CCL20 and SLC7A2 in HCC cell lines (SMMC7721, Huh7, HepG2, and HCCLM3) and the normal liver cell lines (WLR68, and LO2) was indicated by qRT-PCR assays. (D) The protein and (E) mRNA expression of CCL20 and SLC7A2 was analyzed by western blotting and RT-PCR in stable SMMC-7721 cells expressing-shRNA against <t>luciferase</t> or CCL20 and over SLC7A2. (F) Morphology of HCC cells after knockdown of CCL20 and overexpression of SLC7A2. (G) Tumorigenicity of <t>SMMC7721-shCtrl</t> cells and SMMC7721-shCCL20/overSLC7A2 cells in nude mice. (H) Tumor volume was measured every 3 days after tumor formation in nude mice injected with SMMC7721 cells transfected with shCtrl or shCCL20/overSLC7A2. (I, J) Tumor weight was measured in nude mice injected with SMMC7721 cells transfected with shCtrl or shCCL20/overSLC7A2 after 30 days. *p < 0.05; **p < 0.01; ***p < 0.005; ****p < 0.0001, ns, not significant.
Plko 1 Shctrl Puro Target Sequence 5 Cctaaggttaagtcgccctcg 3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko 1 shctrl puro target sequence 5 cctaaggttaagtcgccctcg 3/product/Addgene inc
Average 93 stars, based on 1 article reviews
plko 1 shctrl puro target sequence 5 cctaaggttaagtcgccctcg 3 - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

96
Addgene inc plko 1 puro
Validation of expression and tumorigenicity of hub genes. (A) qRT-PCR validation of MEP1A, CCL20, ADORA2B, TNFSF9, ICAM4, and SLC7A2 in HCC and normal plasmas. (B, C) The mRNA expression level of CCL20 and SLC7A2 in HCC cell lines (SMMC7721, Huh7, HepG2, and HCCLM3) and the normal liver cell lines (WLR68, and LO2) was indicated by qRT-PCR assays. (D) The protein and (E) mRNA expression of CCL20 and SLC7A2 was analyzed by western blotting and RT-PCR in stable SMMC-7721 cells expressing-shRNA against <t>luciferase</t> or CCL20 and over SLC7A2. (F) Morphology of HCC cells after knockdown of CCL20 and overexpression of SLC7A2. (G) Tumorigenicity of <t>SMMC7721-shCtrl</t> cells and SMMC7721-shCCL20/overSLC7A2 cells in nude mice. (H) Tumor volume was measured every 3 days after tumor formation in nude mice injected with SMMC7721 cells transfected with shCtrl or shCCL20/overSLC7A2. (I, J) Tumor weight was measured in nude mice injected with SMMC7721 cells transfected with shCtrl or shCCL20/overSLC7A2 after 30 days. *p < 0.05; **p < 0.01; ***p < 0.005; ****p < 0.0001, ns, not significant.
Plko 1 Puro, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko 1 puro/product/Addgene inc
Average 96 stars, based on 1 article reviews
plko 1 puro - by Bioz Stars, 2026-06
96/100 stars
  Buy from Supplier

96
Addgene inc lentiviral vector plko 1 shrna control shctrl
Reduced TIE2/ Tek levels with SFN are dependent on NRF2 activity. ( A ) bEnd.3 cells were maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h). Expression levels of 84 endothelial genes were analyzed by quantitative real-time PCR (qRT-PCR) and normalized to the geometric mean of Actb , Gapdh , B2m , Gusb , and Hsp90ab1 levels. Volcano plot comparing gene expression of vehicle- versus SFN-treated cells. A fold of change greater than 1.5 is represented by yellow (increased expression when compared to vehicle-treated cells) and blue (decreased expression when compared to vehicle-treated cells) dots. Data are the mean of n = 4. Statistical analysis was performed with the GeneGlobe Data Analysis Center from Qiagen. A p -value < than 0.05 was considered significant and is represented by a line. A red square highlights the Tek gene. ( B ) Representative immunoblots of NRF2 (arrowhead), TIE2, CLDN5, HO-1, and VCL, and GAPDH as a loading control from bEnd.3 cells maintained under low-serum conditions (16 h, 1% FBS) and treated with SFN (5 µM, 16 h). ( C ) Densitometric quantification of NRF2, HO-1, TIE2, and CLDN5 protein levels from representative immunoblots of B expressed as a ratio of VCL and GAPDH, respectively. Data are mean ± S.D. (n = 3). * p < 0.05 and *** p < 0.001 vs. vehicle according to Student’s t -test. ( D ) bEnd.3 cells were maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h). Transcript levels of Hmox1 , Nqo1 , Slc7a11 , Tek , Cldn5 , Cdh5 , Ocln , and Tjp1 were determined by qRT-PCR and normalized to the geometric mean of the levels of Gapdh , Tbp , and Actb . Data are mean ± S.D. (n = 3). * p < 0.05 and *** p < 0.001 vs. vehicle according to Student’s t -test. ( E ) Confocal analysis of double immunofluorescence with anti-TIE2 (green) and anti-CLDN5 (red) antibodies in vehicle (Veh.) or SFN-treated bEnd.3 cells. ( F ) Quantification of TIE2 and CLDN5 intensity signals in E. Values are mean ± SD (n = 3, with >50 cells counted per field). * p < 0.05 vs. VEH-treated cells according to Student’s t -test. ( G ) bEnd.3 cells were transduced with <t>lentiviral</t> vectors carrying short hairpin RNA against NRF2 (shNRF2) or a scramble sequence (shCTRL). Five days post-transduction, cells were maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h). Representative immunoblots of NRF2 (arrowhead), TIE2, CLDN5, HO-1, and LMNB, and GAPDH as a loading control. ( H ) Densitometric quantification of NRF2, HO-1, TIE2, and CLDN5 protein levels from representative immunoblots of G expressed as a ratio of LMNB and GAPDH, respectively. Data are mean ± S.D. (n = 3). * p < 0.05 and ** p < 0.01 vs. vehicle, or # p < 0.05 vs. shCTRL according to Student’s t -test. ( I ) Transcript levels of Nfe2l2 , Hmox1 , Nqo1 , and Slc7a11 and ( J ) of Tek , Cldn5 , Cdh5 , Ocln , and Tjp1 from bEnd.3 cells transduced with shNRF2 or shCTRL maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h) were determined by qRT-PCR and normalized to the geometric mean of the levels of Gapdh , Tbp , and Actb . Data are mean ± S.D. (n = 3). * p < 0.05, ** p < 0.01 and *** p < 0.001 vs. vehicle, or # p < 0.05 and ### p < 0.001 vs. shCTRL according to Student’s t -test.
Lentiviral Vector Plko 1 Shrna Control Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lentiviral vector plko 1 shrna control shctrl/product/Addgene inc
Average 96 stars, based on 1 article reviews
lentiviral vector plko 1 shrna control shctrl - by Bioz Stars, 2026-06
96/100 stars
  Buy from Supplier

94
Addgene inc plko1 neo plasmids
Reduced TIE2/ Tek levels with SFN are dependent on NRF2 activity. ( A ) bEnd.3 cells were maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h). Expression levels of 84 endothelial genes were analyzed by quantitative real-time PCR (qRT-PCR) and normalized to the geometric mean of Actb , Gapdh , B2m , Gusb , and Hsp90ab1 levels. Volcano plot comparing gene expression of vehicle- versus SFN-treated cells. A fold of change greater than 1.5 is represented by yellow (increased expression when compared to vehicle-treated cells) and blue (decreased expression when compared to vehicle-treated cells) dots. Data are the mean of n = 4. Statistical analysis was performed with the GeneGlobe Data Analysis Center from Qiagen. A p -value < than 0.05 was considered significant and is represented by a line. A red square highlights the Tek gene. ( B ) Representative immunoblots of NRF2 (arrowhead), TIE2, CLDN5, HO-1, and VCL, and GAPDH as a loading control from bEnd.3 cells maintained under low-serum conditions (16 h, 1% FBS) and treated with SFN (5 µM, 16 h). ( C ) Densitometric quantification of NRF2, HO-1, TIE2, and CLDN5 protein levels from representative immunoblots of B expressed as a ratio of VCL and GAPDH, respectively. Data are mean ± S.D. (n = 3). * p < 0.05 and *** p < 0.001 vs. vehicle according to Student’s t -test. ( D ) bEnd.3 cells were maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h). Transcript levels of Hmox1 , Nqo1 , Slc7a11 , Tek , Cldn5 , Cdh5 , Ocln , and Tjp1 were determined by qRT-PCR and normalized to the geometric mean of the levels of Gapdh , Tbp , and Actb . Data are mean ± S.D. (n = 3). * p < 0.05 and *** p < 0.001 vs. vehicle according to Student’s t -test. ( E ) Confocal analysis of double immunofluorescence with anti-TIE2 (green) and anti-CLDN5 (red) antibodies in vehicle (Veh.) or SFN-treated bEnd.3 cells. ( F ) Quantification of TIE2 and CLDN5 intensity signals in E. Values are mean ± SD (n = 3, with >50 cells counted per field). * p < 0.05 vs. VEH-treated cells according to Student’s t -test. ( G ) bEnd.3 cells were transduced with <t>lentiviral</t> vectors carrying short hairpin RNA against NRF2 (shNRF2) or a scramble sequence (shCTRL). Five days post-transduction, cells were maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h). Representative immunoblots of NRF2 (arrowhead), TIE2, CLDN5, HO-1, and LMNB, and GAPDH as a loading control. ( H ) Densitometric quantification of NRF2, HO-1, TIE2, and CLDN5 protein levels from representative immunoblots of G expressed as a ratio of LMNB and GAPDH, respectively. Data are mean ± S.D. (n = 3). * p < 0.05 and ** p < 0.01 vs. vehicle, or # p < 0.05 vs. shCTRL according to Student’s t -test. ( I ) Transcript levels of Nfe2l2 , Hmox1 , Nqo1 , and Slc7a11 and ( J ) of Tek , Cldn5 , Cdh5 , Ocln , and Tjp1 from bEnd.3 cells transduced with shNRF2 or shCTRL maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h) were determined by qRT-PCR and normalized to the geometric mean of the levels of Gapdh , Tbp , and Actb . Data are mean ± S.D. (n = 3). * p < 0.05, ** p < 0.01 and *** p < 0.001 vs. vehicle, or # p < 0.05 and ### p < 0.001 vs. shCTRL according to Student’s t -test.
Plko1 Neo Plasmids, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko1 neo plasmids/product/Addgene inc
Average 94 stars, based on 1 article reviews
plko1 neo plasmids - by Bioz Stars, 2026-06
94/100 stars
  Buy from Supplier

94
Addgene inc paper plko 1 hygro addgene plko
Reduced TIE2/ Tek levels with SFN are dependent on NRF2 activity. ( A ) bEnd.3 cells were maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h). Expression levels of 84 endothelial genes were analyzed by quantitative real-time PCR (qRT-PCR) and normalized to the geometric mean of Actb , Gapdh , B2m , Gusb , and Hsp90ab1 levels. Volcano plot comparing gene expression of vehicle- versus SFN-treated cells. A fold of change greater than 1.5 is represented by yellow (increased expression when compared to vehicle-treated cells) and blue (decreased expression when compared to vehicle-treated cells) dots. Data are the mean of n = 4. Statistical analysis was performed with the GeneGlobe Data Analysis Center from Qiagen. A p -value < than 0.05 was considered significant and is represented by a line. A red square highlights the Tek gene. ( B ) Representative immunoblots of NRF2 (arrowhead), TIE2, CLDN5, HO-1, and VCL, and GAPDH as a loading control from bEnd.3 cells maintained under low-serum conditions (16 h, 1% FBS) and treated with SFN (5 µM, 16 h). ( C ) Densitometric quantification of NRF2, HO-1, TIE2, and CLDN5 protein levels from representative immunoblots of B expressed as a ratio of VCL and GAPDH, respectively. Data are mean ± S.D. (n = 3). * p < 0.05 and *** p < 0.001 vs. vehicle according to Student’s t -test. ( D ) bEnd.3 cells were maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h). Transcript levels of Hmox1 , Nqo1 , Slc7a11 , Tek , Cldn5 , Cdh5 , Ocln , and Tjp1 were determined by qRT-PCR and normalized to the geometric mean of the levels of Gapdh , Tbp , and Actb . Data are mean ± S.D. (n = 3). * p < 0.05 and *** p < 0.001 vs. vehicle according to Student’s t -test. ( E ) Confocal analysis of double immunofluorescence with anti-TIE2 (green) and anti-CLDN5 (red) antibodies in vehicle (Veh.) or SFN-treated bEnd.3 cells. ( F ) Quantification of TIE2 and CLDN5 intensity signals in E. Values are mean ± SD (n = 3, with >50 cells counted per field). * p < 0.05 vs. VEH-treated cells according to Student’s t -test. ( G ) bEnd.3 cells were transduced with <t>lentiviral</t> vectors carrying short hairpin RNA against NRF2 (shNRF2) or a scramble sequence (shCTRL). Five days post-transduction, cells were maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h). Representative immunoblots of NRF2 (arrowhead), TIE2, CLDN5, HO-1, and LMNB, and GAPDH as a loading control. ( H ) Densitometric quantification of NRF2, HO-1, TIE2, and CLDN5 protein levels from representative immunoblots of G expressed as a ratio of LMNB and GAPDH, respectively. Data are mean ± S.D. (n = 3). * p < 0.05 and ** p < 0.01 vs. vehicle, or # p < 0.05 vs. shCTRL according to Student’s t -test. ( I ) Transcript levels of Nfe2l2 , Hmox1 , Nqo1 , and Slc7a11 and ( J ) of Tek , Cldn5 , Cdh5 , Ocln , and Tjp1 from bEnd.3 cells transduced with shNRF2 or shCTRL maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h) were determined by qRT-PCR and normalized to the geometric mean of the levels of Gapdh , Tbp , and Actb . Data are mean ± S.D. (n = 3). * p < 0.05, ** p < 0.01 and *** p < 0.001 vs. vehicle, or # p < 0.05 and ### p < 0.001 vs. shCTRL according to Student’s t -test.
Paper Plko 1 Hygro Addgene Plko, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/paper plko 1 hygro addgene plko/product/Addgene inc
Average 94 stars, based on 1 article reviews
paper plko 1 hygro addgene plko - by Bioz Stars, 2026-06
94/100 stars
  Buy from Supplier

96
Addgene inc paper plko
Reduced TIE2/ Tek levels with SFN are dependent on NRF2 activity. ( A ) bEnd.3 cells were maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h). Expression levels of 84 endothelial genes were analyzed by quantitative real-time PCR (qRT-PCR) and normalized to the geometric mean of Actb , Gapdh , B2m , Gusb , and Hsp90ab1 levels. Volcano plot comparing gene expression of vehicle- versus SFN-treated cells. A fold of change greater than 1.5 is represented by yellow (increased expression when compared to vehicle-treated cells) and blue (decreased expression when compared to vehicle-treated cells) dots. Data are the mean of n = 4. Statistical analysis was performed with the GeneGlobe Data Analysis Center from Qiagen. A p -value < than 0.05 was considered significant and is represented by a line. A red square highlights the Tek gene. ( B ) Representative immunoblots of NRF2 (arrowhead), TIE2, CLDN5, HO-1, and VCL, and GAPDH as a loading control from bEnd.3 cells maintained under low-serum conditions (16 h, 1% FBS) and treated with SFN (5 µM, 16 h). ( C ) Densitometric quantification of NRF2, HO-1, TIE2, and CLDN5 protein levels from representative immunoblots of B expressed as a ratio of VCL and GAPDH, respectively. Data are mean ± S.D. (n = 3). * p < 0.05 and *** p < 0.001 vs. vehicle according to Student’s t -test. ( D ) bEnd.3 cells were maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h). Transcript levels of Hmox1 , Nqo1 , Slc7a11 , Tek , Cldn5 , Cdh5 , Ocln , and Tjp1 were determined by qRT-PCR and normalized to the geometric mean of the levels of Gapdh , Tbp , and Actb . Data are mean ± S.D. (n = 3). * p < 0.05 and *** p < 0.001 vs. vehicle according to Student’s t -test. ( E ) Confocal analysis of double immunofluorescence with anti-TIE2 (green) and anti-CLDN5 (red) antibodies in vehicle (Veh.) or SFN-treated bEnd.3 cells. ( F ) Quantification of TIE2 and CLDN5 intensity signals in E. Values are mean ± SD (n = 3, with >50 cells counted per field). * p < 0.05 vs. VEH-treated cells according to Student’s t -test. ( G ) bEnd.3 cells were transduced with <t>lentiviral</t> vectors carrying short hairpin RNA against NRF2 (shNRF2) or a scramble sequence (shCTRL). Five days post-transduction, cells were maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h). Representative immunoblots of NRF2 (arrowhead), TIE2, CLDN5, HO-1, and LMNB, and GAPDH as a loading control. ( H ) Densitometric quantification of NRF2, HO-1, TIE2, and CLDN5 protein levels from representative immunoblots of G expressed as a ratio of LMNB and GAPDH, respectively. Data are mean ± S.D. (n = 3). * p < 0.05 and ** p < 0.01 vs. vehicle, or # p < 0.05 vs. shCTRL according to Student’s t -test. ( I ) Transcript levels of Nfe2l2 , Hmox1 , Nqo1 , and Slc7a11 and ( J ) of Tek , Cldn5 , Cdh5 , Ocln , and Tjp1 from bEnd.3 cells transduced with shNRF2 or shCTRL maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h) were determined by qRT-PCR and normalized to the geometric mean of the levels of Gapdh , Tbp , and Actb . Data are mean ± S.D. (n = 3). * p < 0.05, ** p < 0.01 and *** p < 0.001 vs. vehicle, or # p < 0.05 and ### p < 0.001 vs. shCTRL according to Student’s t -test.
Paper Plko, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/paper plko/product/Addgene inc
Average 96 stars, based on 1 article reviews
paper plko - by Bioz Stars, 2026-06
96/100 stars
  Buy from Supplier

93
Addgene inc plko 1 puro shp53
a, Barplot of Annexin V + cells (%) in early and late apoptotic phase (EA - LA) detected by flow cytometry with Annexin V-APC staining and PI counterstain, in DAOY, UW228 and ONS76 in control or AMBRA1-depleted condition (n=3). b , Scatter plot distribution of Chronos corrected GeneEffect of CRISPR KO over mRNA expression in ONS76 cell line from DepMap. c , ( Left panel ) IB for the indicated proteins of whole-cell extracts from control ( shCTRL ) or p53 constitutively downregulated ONS76 cells in scramble or AMBRA1-depleted ( <t>shp53</t> ). 24 hrs before harvesting cells were treated without or with 200 nM AZD7762 (n=3). ( Right panel ) Barplot of γH2AX normalized protein levels observed in c (n=3). d , IB for the indicated proteins of whole-cell extracts from control (shCTRL) or p53 constitutively downregulated ONS76 cells in scramble or AMBRA1-depleted. 24 hrs before harvesting cells were treated with or without 200 nM AZD7762 (n=3) . e , Boxplot of cell number from shCTRL or shp53 ONS76 cells in a scramble or AMBRA1-depleted condition. f , ( Left panel ) Scatter plot distribution of Chronos corrected GeneEffect of CRISPR KO for AMBRA1 and TP53 from 24Q4 DepMap release; MB cell lines in red. ( Right panel ) Table with Top6 co-dependent gene with AMBRA1. g , Boxplot for mRNA log2 expression of AMBRA1 in the different SHH subgroups derived from the publicly available dataset Cavalli (763 patients, fpkm normalized, mb500rs1 chip). SHH-α = 65; SHH-β = 35; SHH-Δ = 76; SHH-γ = 47. h , A comprehensive model illustrating how reduced AMBRA1 levels lead to the accumulation of RS. Data were analyzed using either with two-way ANOVA ( a ), or one-way ANOVA ( b , e ) Welch’s two-tailed unpaired t-test ( g )
Plko 1 Puro Shp53, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko 1 puro shp53/product/Addgene inc
Average 93 stars, based on 1 article reviews
plko 1 puro shp53 - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

90
Addgene inc plko 1 puro shsmad2
a, Barplot of Annexin V + cells (%) in early and late apoptotic phase (EA - LA) detected by flow cytometry with Annexin V-APC staining and PI counterstain, in DAOY, UW228 and ONS76 in control or AMBRA1-depleted condition (n=3). b , Scatter plot distribution of Chronos corrected GeneEffect of CRISPR KO over mRNA expression in ONS76 cell line from DepMap. c , ( Left panel ) IB for the indicated proteins of whole-cell extracts from control ( shCTRL ) or p53 constitutively downregulated ONS76 cells in scramble or AMBRA1-depleted ( <t>shp53</t> ). 24 hrs before harvesting cells were treated without or with 200 nM AZD7762 (n=3). ( Right panel ) Barplot of γH2AX normalized protein levels observed in c (n=3). d , IB for the indicated proteins of whole-cell extracts from control (shCTRL) or p53 constitutively downregulated ONS76 cells in scramble or AMBRA1-depleted. 24 hrs before harvesting cells were treated with or without 200 nM AZD7762 (n=3) . e , Boxplot of cell number from shCTRL or shp53 ONS76 cells in a scramble or AMBRA1-depleted condition. f , ( Left panel ) Scatter plot distribution of Chronos corrected GeneEffect of CRISPR KO for AMBRA1 and TP53 from 24Q4 DepMap release; MB cell lines in red. ( Right panel ) Table with Top6 co-dependent gene with AMBRA1. g , Boxplot for mRNA log2 expression of AMBRA1 in the different SHH subgroups derived from the publicly available dataset Cavalli (763 patients, fpkm normalized, mb500rs1 chip). SHH-α = 65; SHH-β = 35; SHH-Δ = 76; SHH-γ = 47. h , A comprehensive model illustrating how reduced AMBRA1 levels lead to the accumulation of RS. Data were analyzed using either with two-way ANOVA ( a ), or one-way ANOVA ( b , e ) Welch’s two-tailed unpaired t-test ( g )
Plko 1 Puro Shsmad2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko 1 puro shsmad2/product/Addgene inc
Average 90 stars, based on 1 article reviews
plko 1 puro shsmad2 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

94
Addgene inc paper pbabe puro mcherry egfp lc3b addgene pgl4 20 promega pgl4 20
a, Barplot of Annexin V + cells (%) in early and late apoptotic phase (EA - LA) detected by flow cytometry with Annexin V-APC staining and PI counterstain, in DAOY, UW228 and ONS76 in control or AMBRA1-depleted condition (n=3). b , Scatter plot distribution of Chronos corrected GeneEffect of CRISPR KO over mRNA expression in ONS76 cell line from DepMap. c , ( Left panel ) IB for the indicated proteins of whole-cell extracts from control ( shCTRL ) or p53 constitutively downregulated ONS76 cells in scramble or AMBRA1-depleted ( <t>shp53</t> ). 24 hrs before harvesting cells were treated without or with 200 nM AZD7762 (n=3). ( Right panel ) Barplot of γH2AX normalized protein levels observed in c (n=3). d , IB for the indicated proteins of whole-cell extracts from control (shCTRL) or p53 constitutively downregulated ONS76 cells in scramble or AMBRA1-depleted. 24 hrs before harvesting cells were treated with or without 200 nM AZD7762 (n=3) . e , Boxplot of cell number from shCTRL or shp53 ONS76 cells in a scramble or AMBRA1-depleted condition. f , ( Left panel ) Scatter plot distribution of Chronos corrected GeneEffect of CRISPR KO for AMBRA1 and TP53 from 24Q4 DepMap release; MB cell lines in red. ( Right panel ) Table with Top6 co-dependent gene with AMBRA1. g , Boxplot for mRNA log2 expression of AMBRA1 in the different SHH subgroups derived from the publicly available dataset Cavalli (763 patients, fpkm normalized, mb500rs1 chip). SHH-α = 65; SHH-β = 35; SHH-Δ = 76; SHH-γ = 47. h , A comprehensive model illustrating how reduced AMBRA1 levels lead to the accumulation of RS. Data were analyzed using either with two-way ANOVA ( a ), or one-way ANOVA ( b , e ) Welch’s two-tailed unpaired t-test ( g )
Paper Pbabe Puro Mcherry Egfp Lc3b Addgene Pgl4 20 Promega Pgl4 20, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/paper pbabe puro mcherry egfp lc3b addgene pgl4 20 promega pgl4 20/product/Addgene inc
Average 94 stars, based on 1 article reviews
paper pbabe puro mcherry egfp lc3b addgene pgl4 20 promega pgl4 20 - by Bioz Stars, 2026-06
94/100 stars
  Buy from Supplier

Image Search Results


Validation of expression and tumorigenicity of hub genes. (A) qRT-PCR validation of MEP1A, CCL20, ADORA2B, TNFSF9, ICAM4, and SLC7A2 in HCC and normal plasmas. (B, C) The mRNA expression level of CCL20 and SLC7A2 in HCC cell lines (SMMC7721, Huh7, HepG2, and HCCLM3) and the normal liver cell lines (WLR68, and LO2) was indicated by qRT-PCR assays. (D) The protein and (E) mRNA expression of CCL20 and SLC7A2 was analyzed by western blotting and RT-PCR in stable SMMC-7721 cells expressing-shRNA against luciferase or CCL20 and over SLC7A2. (F) Morphology of HCC cells after knockdown of CCL20 and overexpression of SLC7A2. (G) Tumorigenicity of SMMC7721-shCtrl cells and SMMC7721-shCCL20/overSLC7A2 cells in nude mice. (H) Tumor volume was measured every 3 days after tumor formation in nude mice injected with SMMC7721 cells transfected with shCtrl or shCCL20/overSLC7A2. (I, J) Tumor weight was measured in nude mice injected with SMMC7721 cells transfected with shCtrl or shCCL20/overSLC7A2 after 30 days. *p < 0.05; **p < 0.01; ***p < 0.005; ****p < 0.0001, ns, not significant.

Journal: Frontiers in Oncology

Article Title: An inflammation-related gene landscape predicts prognosis and response to immunotherapy in virus-associated hepatocellular carcinoma

doi: 10.3389/fonc.2023.1118152

Figure Lengend Snippet: Validation of expression and tumorigenicity of hub genes. (A) qRT-PCR validation of MEP1A, CCL20, ADORA2B, TNFSF9, ICAM4, and SLC7A2 in HCC and normal plasmas. (B, C) The mRNA expression level of CCL20 and SLC7A2 in HCC cell lines (SMMC7721, Huh7, HepG2, and HCCLM3) and the normal liver cell lines (WLR68, and LO2) was indicated by qRT-PCR assays. (D) The protein and (E) mRNA expression of CCL20 and SLC7A2 was analyzed by western blotting and RT-PCR in stable SMMC-7721 cells expressing-shRNA against luciferase or CCL20 and over SLC7A2. (F) Morphology of HCC cells after knockdown of CCL20 and overexpression of SLC7A2. (G) Tumorigenicity of SMMC7721-shCtrl cells and SMMC7721-shCCL20/overSLC7A2 cells in nude mice. (H) Tumor volume was measured every 3 days after tumor formation in nude mice injected with SMMC7721 cells transfected with shCtrl or shCCL20/overSLC7A2. (I, J) Tumor weight was measured in nude mice injected with SMMC7721 cells transfected with shCtrl or shCCL20/overSLC7A2 after 30 days. *p < 0.05; **p < 0.01; ***p < 0.005; ****p < 0.0001, ns, not significant.

Article Snippet: Full-length SLC7A2 cDNA was synthesized and cloned into the pCS-CG vector (Addgene, Cambridge, MA, USA). shRNA sequences specifically against CCL20 (shCCL20) and control-shRNA against luciferase (shCtrl) were expressed from pLKO.1-puro (Addgene, Cambridge, MA, USA).

Techniques: Biomarker Discovery, Expressing, Quantitative RT-PCR, Western Blot, Reverse Transcription Polymerase Chain Reaction, shRNA, Luciferase, Knockdown, Over Expression, Injection, Transfection

Reduced TIE2/ Tek levels with SFN are dependent on NRF2 activity. ( A ) bEnd.3 cells were maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h). Expression levels of 84 endothelial genes were analyzed by quantitative real-time PCR (qRT-PCR) and normalized to the geometric mean of Actb , Gapdh , B2m , Gusb , and Hsp90ab1 levels. Volcano plot comparing gene expression of vehicle- versus SFN-treated cells. A fold of change greater than 1.5 is represented by yellow (increased expression when compared to vehicle-treated cells) and blue (decreased expression when compared to vehicle-treated cells) dots. Data are the mean of n = 4. Statistical analysis was performed with the GeneGlobe Data Analysis Center from Qiagen. A p -value < than 0.05 was considered significant and is represented by a line. A red square highlights the Tek gene. ( B ) Representative immunoblots of NRF2 (arrowhead), TIE2, CLDN5, HO-1, and VCL, and GAPDH as a loading control from bEnd.3 cells maintained under low-serum conditions (16 h, 1% FBS) and treated with SFN (5 µM, 16 h). ( C ) Densitometric quantification of NRF2, HO-1, TIE2, and CLDN5 protein levels from representative immunoblots of B expressed as a ratio of VCL and GAPDH, respectively. Data are mean ± S.D. (n = 3). * p < 0.05 and *** p < 0.001 vs. vehicle according to Student’s t -test. ( D ) bEnd.3 cells were maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h). Transcript levels of Hmox1 , Nqo1 , Slc7a11 , Tek , Cldn5 , Cdh5 , Ocln , and Tjp1 were determined by qRT-PCR and normalized to the geometric mean of the levels of Gapdh , Tbp , and Actb . Data are mean ± S.D. (n = 3). * p < 0.05 and *** p < 0.001 vs. vehicle according to Student’s t -test. ( E ) Confocal analysis of double immunofluorescence with anti-TIE2 (green) and anti-CLDN5 (red) antibodies in vehicle (Veh.) or SFN-treated bEnd.3 cells. ( F ) Quantification of TIE2 and CLDN5 intensity signals in E. Values are mean ± SD (n = 3, with >50 cells counted per field). * p < 0.05 vs. VEH-treated cells according to Student’s t -test. ( G ) bEnd.3 cells were transduced with lentiviral vectors carrying short hairpin RNA against NRF2 (shNRF2) or a scramble sequence (shCTRL). Five days post-transduction, cells were maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h). Representative immunoblots of NRF2 (arrowhead), TIE2, CLDN5, HO-1, and LMNB, and GAPDH as a loading control. ( H ) Densitometric quantification of NRF2, HO-1, TIE2, and CLDN5 protein levels from representative immunoblots of G expressed as a ratio of LMNB and GAPDH, respectively. Data are mean ± S.D. (n = 3). * p < 0.05 and ** p < 0.01 vs. vehicle, or # p < 0.05 vs. shCTRL according to Student’s t -test. ( I ) Transcript levels of Nfe2l2 , Hmox1 , Nqo1 , and Slc7a11 and ( J ) of Tek , Cldn5 , Cdh5 , Ocln , and Tjp1 from bEnd.3 cells transduced with shNRF2 or shCTRL maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h) were determined by qRT-PCR and normalized to the geometric mean of the levels of Gapdh , Tbp , and Actb . Data are mean ± S.D. (n = 3). * p < 0.05, ** p < 0.01 and *** p < 0.001 vs. vehicle, or # p < 0.05 and ### p < 0.001 vs. shCTRL according to Student’s t -test.

Journal: International Journal of Molecular Sciences

Article Title: Modulation of the Receptor Tyrosine Kinase TIE2/ Tek Pathway by NRF2 Activation in Neurovascular Endothelial Cells

doi: 10.3390/ijms27020770

Figure Lengend Snippet: Reduced TIE2/ Tek levels with SFN are dependent on NRF2 activity. ( A ) bEnd.3 cells were maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h). Expression levels of 84 endothelial genes were analyzed by quantitative real-time PCR (qRT-PCR) and normalized to the geometric mean of Actb , Gapdh , B2m , Gusb , and Hsp90ab1 levels. Volcano plot comparing gene expression of vehicle- versus SFN-treated cells. A fold of change greater than 1.5 is represented by yellow (increased expression when compared to vehicle-treated cells) and blue (decreased expression when compared to vehicle-treated cells) dots. Data are the mean of n = 4. Statistical analysis was performed with the GeneGlobe Data Analysis Center from Qiagen. A p -value < than 0.05 was considered significant and is represented by a line. A red square highlights the Tek gene. ( B ) Representative immunoblots of NRF2 (arrowhead), TIE2, CLDN5, HO-1, and VCL, and GAPDH as a loading control from bEnd.3 cells maintained under low-serum conditions (16 h, 1% FBS) and treated with SFN (5 µM, 16 h). ( C ) Densitometric quantification of NRF2, HO-1, TIE2, and CLDN5 protein levels from representative immunoblots of B expressed as a ratio of VCL and GAPDH, respectively. Data are mean ± S.D. (n = 3). * p < 0.05 and *** p < 0.001 vs. vehicle according to Student’s t -test. ( D ) bEnd.3 cells were maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h). Transcript levels of Hmox1 , Nqo1 , Slc7a11 , Tek , Cldn5 , Cdh5 , Ocln , and Tjp1 were determined by qRT-PCR and normalized to the geometric mean of the levels of Gapdh , Tbp , and Actb . Data are mean ± S.D. (n = 3). * p < 0.05 and *** p < 0.001 vs. vehicle according to Student’s t -test. ( E ) Confocal analysis of double immunofluorescence with anti-TIE2 (green) and anti-CLDN5 (red) antibodies in vehicle (Veh.) or SFN-treated bEnd.3 cells. ( F ) Quantification of TIE2 and CLDN5 intensity signals in E. Values are mean ± SD (n = 3, with >50 cells counted per field). * p < 0.05 vs. VEH-treated cells according to Student’s t -test. ( G ) bEnd.3 cells were transduced with lentiviral vectors carrying short hairpin RNA against NRF2 (shNRF2) or a scramble sequence (shCTRL). Five days post-transduction, cells were maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h). Representative immunoblots of NRF2 (arrowhead), TIE2, CLDN5, HO-1, and LMNB, and GAPDH as a loading control. ( H ) Densitometric quantification of NRF2, HO-1, TIE2, and CLDN5 protein levels from representative immunoblots of G expressed as a ratio of LMNB and GAPDH, respectively. Data are mean ± S.D. (n = 3). * p < 0.05 and ** p < 0.01 vs. vehicle, or # p < 0.05 vs. shCTRL according to Student’s t -test. ( I ) Transcript levels of Nfe2l2 , Hmox1 , Nqo1 , and Slc7a11 and ( J ) of Tek , Cldn5 , Cdh5 , Ocln , and Tjp1 from bEnd.3 cells transduced with shNRF2 or shCTRL maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h) were determined by qRT-PCR and normalized to the geometric mean of the levels of Gapdh , Tbp , and Actb . Data are mean ± S.D. (n = 3). * p < 0.05, ** p < 0.01 and *** p < 0.001 vs. vehicle, or # p < 0.05 and ### p < 0.001 vs. shCTRL according to Student’s t -test.

Article Snippet: Lentiviral vector pLKO.1 shRNA control (shCtrl) (Addgene Plasmid #10879) was purchased from Addgene; pLKO-puro shNRF2 (NM_010902) was purchased from Sigma-Aldrich.

Techniques: Activity Assay, Expressing, Real-time Polymerase Chain Reaction, Quantitative RT-PCR, Gene Expression, Western Blot, Control, Immunofluorescence, Transduction, shRNA, Sequencing

Overexpression of NRF2 alters TIE2/ Tek levels. ( A ) bEnd.3 cells were transduced with lentiviral vectors carrying overexpressed NRF2 insensitive to KEAP1 degradation (NRF2 ∆ETGE ) or a lentivirus empty vector. Five days post-transduction, cells were maintained under low-serum conditions (16 h, 1% FBS). Representative immunoblots of NRF2 (arrowhead), TIE2, CLDN5, HO-1, and VCL, and GAPDH as a loading control. ( B ) Densitometric quantification of NRF2, HO-1, TIE2, and CLDN5 protein levels from representative immunoblots of A expressed as a ratio of VCL and GAPDH, respectively. Data are mean ± S.D. (n = 3). * p < 0.05 and *** p < 0.001 vs. empty vector according to Student’s t -test. ( C ) Transcript levels of Hmox1 , Nqo1 , and Slc7a11 and ( D ) of Tek , Cldn5 , Cdh5 , Ocln , and Tjp1 from bEnd.3 cells transduced with NRF2 ∆ETGE or empty vector maintained under low-serum conditions (16 h, 1% FBS) were determined by qRT-PCR and normalized to the geometric mean of the levels of Gapdh , Tbp , and Actb . Data are mean ± S.D. (n = 3). ** p < 0.01 and *** p < 0.001 vs. empty vector according to Student’s t -test. ( E ) bEnd.3 cells were transduced with lentiviral vectors NRF2 ∆ETGE or an empty vector. Five days post-transduction, cells were maintained under low-serum conditions (16 h, 1% FBS) and were subjected to ANGPT1 (400 ng/mL) purified from supernatant HEK293T-stable expression (CMP-ANGPT1) to the indicated time points. Representative immunoblots of NRF2 (arrowhead), TIE2, CLDN5, HO-1, and VCL, and GAPDH as a loading control. ( F ) Densitometric quantification of NRF2, TIE2, and CLDN5 protein levels from representative immunoblots of E expressed as a ratio of VCL and GAPDH, respectively. Data are mean ± S.D. (n = 3). * p < 0.05, ** p < 0.01 and *** p < 0.001 vs. time 0 according to a one-way ANOVA followed by a Bonferroni post hoc test.

Journal: International Journal of Molecular Sciences

Article Title: Modulation of the Receptor Tyrosine Kinase TIE2/ Tek Pathway by NRF2 Activation in Neurovascular Endothelial Cells

doi: 10.3390/ijms27020770

Figure Lengend Snippet: Overexpression of NRF2 alters TIE2/ Tek levels. ( A ) bEnd.3 cells were transduced with lentiviral vectors carrying overexpressed NRF2 insensitive to KEAP1 degradation (NRF2 ∆ETGE ) or a lentivirus empty vector. Five days post-transduction, cells were maintained under low-serum conditions (16 h, 1% FBS). Representative immunoblots of NRF2 (arrowhead), TIE2, CLDN5, HO-1, and VCL, and GAPDH as a loading control. ( B ) Densitometric quantification of NRF2, HO-1, TIE2, and CLDN5 protein levels from representative immunoblots of A expressed as a ratio of VCL and GAPDH, respectively. Data are mean ± S.D. (n = 3). * p < 0.05 and *** p < 0.001 vs. empty vector according to Student’s t -test. ( C ) Transcript levels of Hmox1 , Nqo1 , and Slc7a11 and ( D ) of Tek , Cldn5 , Cdh5 , Ocln , and Tjp1 from bEnd.3 cells transduced with NRF2 ∆ETGE or empty vector maintained under low-serum conditions (16 h, 1% FBS) were determined by qRT-PCR and normalized to the geometric mean of the levels of Gapdh , Tbp , and Actb . Data are mean ± S.D. (n = 3). ** p < 0.01 and *** p < 0.001 vs. empty vector according to Student’s t -test. ( E ) bEnd.3 cells were transduced with lentiviral vectors NRF2 ∆ETGE or an empty vector. Five days post-transduction, cells were maintained under low-serum conditions (16 h, 1% FBS) and were subjected to ANGPT1 (400 ng/mL) purified from supernatant HEK293T-stable expression (CMP-ANGPT1) to the indicated time points. Representative immunoblots of NRF2 (arrowhead), TIE2, CLDN5, HO-1, and VCL, and GAPDH as a loading control. ( F ) Densitometric quantification of NRF2, TIE2, and CLDN5 protein levels from representative immunoblots of E expressed as a ratio of VCL and GAPDH, respectively. Data are mean ± S.D. (n = 3). * p < 0.05, ** p < 0.01 and *** p < 0.001 vs. time 0 according to a one-way ANOVA followed by a Bonferroni post hoc test.

Article Snippet: Lentiviral vector pLKO.1 shRNA control (shCtrl) (Addgene Plasmid #10879) was purchased from Addgene; pLKO-puro shNRF2 (NM_010902) was purchased from Sigma-Aldrich.

Techniques: Over Expression, Transduction, Plasmid Preparation, Western Blot, Control, Quantitative RT-PCR, Purification, Expressing

Repression of TIE2/ Tek levels by NRF2 is not dependent on BACH1. ( A ) Subcellular fraction from bEnd.3 maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM) and hemin (10 µM) treatments for 16 h. Representative immunoblots of NRF2 (arrowhead), BACH1, TIE2, CLDN5, HO-1, and LMNB, and GAPDH as a loading control. Densitometric quantification of BACH1 ( B ), NRF2 nuclear ( C ), TIE2 cytosol ( D ), and HO-1 cytosol ( E ) protein levels from representative immunoblots of A expressed as a ratio of LMNB for nuclear fraction and GAPDH for cytosol fraction, respectively. Data are mean ± S.D. (n = 3). * p < 0.05, ** p < 0.01 and *** p < 0.001 vs. vehicle according to Student’s t -test. ( F , G ) bEnd.3 cells were maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM) and hemin (10 µM) treatments for 16 h. Transcript levels of Hmox1 , Nqo1 , and Slc7a11 ( F ) and Tek , Bach1 , and Cldn5 ( G ) were determined by qRT-PCR and normalized to the geometric mean of the levels of Gapdh , Tbp , and Actb . Data are mean ± S.D. (n = 3). * p < 0.05, ** p < 0.05 and *** p < 0.001 vs. vehicle according to Student’s t -test. ( H ) bEnd.3 cells were transduced with lentiviral vectors carrying short hairpin RNA against BACH1 (shBACH1) or a scramble sequence (shCTRL). Five days post-transduction, cells were maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h). Representative immunoblots of NRF2 (arrowhead), BACH1, TIE2, CLDN5, HO-1, and VCL, and GAPDH as a loading control. ( I ) Densitometric quantification of NRF2, BACH1, HO-1, TIE2, and CLDN5 protein levels from representative immunoblots of H expressed as a ratio of VCL and GAPDH, respectively. Data are mean ± S.D. (n = 3). * p < 0.05, ** p < 0.01 and *** p < 0.001 vs. vehicle, or ### p < 0.001 vs. shCTRL according to Student’s t -test. ( J ) Transcript levels of Hmox1 , Nqo1 , Bach1 , Tek , and Cldn5 from bEnd.3 cells transduced with shBACH1 or shCTRL maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h) were determined by qRT-PCR and normalized to the geometric mean of the levels of Gapdh , Tbp , and Actb . Data are mean ± S.D. (n = 3). * p < 0.05, ** p < 0.01 and *** p < 0.001 vs. vehicle, or # p < 0.05 and ### p < 0.001 vs. shCTRL according to Student’s t -test. ns indicates not significant.

Journal: International Journal of Molecular Sciences

Article Title: Modulation of the Receptor Tyrosine Kinase TIE2/ Tek Pathway by NRF2 Activation in Neurovascular Endothelial Cells

doi: 10.3390/ijms27020770

Figure Lengend Snippet: Repression of TIE2/ Tek levels by NRF2 is not dependent on BACH1. ( A ) Subcellular fraction from bEnd.3 maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM) and hemin (10 µM) treatments for 16 h. Representative immunoblots of NRF2 (arrowhead), BACH1, TIE2, CLDN5, HO-1, and LMNB, and GAPDH as a loading control. Densitometric quantification of BACH1 ( B ), NRF2 nuclear ( C ), TIE2 cytosol ( D ), and HO-1 cytosol ( E ) protein levels from representative immunoblots of A expressed as a ratio of LMNB for nuclear fraction and GAPDH for cytosol fraction, respectively. Data are mean ± S.D. (n = 3). * p < 0.05, ** p < 0.01 and *** p < 0.001 vs. vehicle according to Student’s t -test. ( F , G ) bEnd.3 cells were maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM) and hemin (10 µM) treatments for 16 h. Transcript levels of Hmox1 , Nqo1 , and Slc7a11 ( F ) and Tek , Bach1 , and Cldn5 ( G ) were determined by qRT-PCR and normalized to the geometric mean of the levels of Gapdh , Tbp , and Actb . Data are mean ± S.D. (n = 3). * p < 0.05, ** p < 0.05 and *** p < 0.001 vs. vehicle according to Student’s t -test. ( H ) bEnd.3 cells were transduced with lentiviral vectors carrying short hairpin RNA against BACH1 (shBACH1) or a scramble sequence (shCTRL). Five days post-transduction, cells were maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h). Representative immunoblots of NRF2 (arrowhead), BACH1, TIE2, CLDN5, HO-1, and VCL, and GAPDH as a loading control. ( I ) Densitometric quantification of NRF2, BACH1, HO-1, TIE2, and CLDN5 protein levels from representative immunoblots of H expressed as a ratio of VCL and GAPDH, respectively. Data are mean ± S.D. (n = 3). * p < 0.05, ** p < 0.01 and *** p < 0.001 vs. vehicle, or ### p < 0.001 vs. shCTRL according to Student’s t -test. ( J ) Transcript levels of Hmox1 , Nqo1 , Bach1 , Tek , and Cldn5 from bEnd.3 cells transduced with shBACH1 or shCTRL maintained under low-serum conditions (16 h, 1% FBS) and subjected to SFN (5 µM, 16 h) were determined by qRT-PCR and normalized to the geometric mean of the levels of Gapdh , Tbp , and Actb . Data are mean ± S.D. (n = 3). * p < 0.05, ** p < 0.01 and *** p < 0.001 vs. vehicle, or # p < 0.05 and ### p < 0.001 vs. shCTRL according to Student’s t -test. ns indicates not significant.

Article Snippet: Lentiviral vector pLKO.1 shRNA control (shCtrl) (Addgene Plasmid #10879) was purchased from Addgene; pLKO-puro shNRF2 (NM_010902) was purchased from Sigma-Aldrich.

Techniques: Western Blot, Control, Quantitative RT-PCR, Transduction, shRNA, Sequencing

NRF2 does not modify Tek mRNA stability and does not bind its promoter. ( A ) bEnd.3 were maintained under low-serum conditions (16 h, 1% FBS), pre-treated with SFN (5 µM, 6 h), and subsequently subjected to actinomycin D (5 µg/mL) or sustained SFN (5 µM) at the indicated time points. The graph depicts the natural logarithm of the relative levels of the Tek mRNA as a function of actinomycin D or actinomycin D/SFN incubation time, normalized to the geometric mean of the levels of Gapdh , Tbp , and Actb . The mRNA half-life was determined using the linear part of the degradation curve. Data are mean ± S.D. (n = 3). No statistically significant differences ( p ≤ 0.05) were detected between vehicle- and SFN-treated groups at any of the analyzed time points according to a two-way ANOVA followed by a Bonferroni post hoc test. ( B ) Representative immunoblots of NRF2 (arrowhead) and TIE2, as well as VCL as a loading control, from bEnd.3 were maintained under low-serum conditions (16 h, 1% FBS), pre-treated with SFN (5 µM, 6 h), and subsequently subjected to CHX (100 µM) or sustained SFN (5 µM) at the indicated time points. ( C ) The graph depicts the natural logarithm of the relative levels of the TIE2 protein as a function of CHX or CHX/SFN incubation time from representative immunoblots of A normalized to VCL. The protein half-life was determined using the linear part of the degradation curve. Data are mean ± S.D. (n = 3). No statistically significant differences ( p ≤ 0.05) were detected between vehicle- and SFN-treated groups at any of the analyzed time points according to a two-way ANOVA followed by a Bonferroni post hoc test. ( D ) bEnd.3 cells were transduced with lentiviral vectors carrying overexpressed NRF2 insensitive to KEAP1 degradation (NRF2 ∆ETGE ) or a lentivirus empty vector. Five days post-transduction, cells were maintained under low-serum conditions (16 h, 1% FBS). Chromatin immunoprecipitation (ChIP) analysis was performed with anti-IgG or anti-PolII antibodies, and the potential AREs in Tek with the highest were analyzed by qRT-PCR. The figure shows representative data normalized as the fold of enrichment with the anti-PolII antibody vs. the IgG antibody. The presence of already known AREs in Hmox1 (ARE1), Hmox1 (ARE2), and Nqo1 was analyzed as a positive control, and Actb was amplified as a negative control.

Journal: International Journal of Molecular Sciences

Article Title: Modulation of the Receptor Tyrosine Kinase TIE2/ Tek Pathway by NRF2 Activation in Neurovascular Endothelial Cells

doi: 10.3390/ijms27020770

Figure Lengend Snippet: NRF2 does not modify Tek mRNA stability and does not bind its promoter. ( A ) bEnd.3 were maintained under low-serum conditions (16 h, 1% FBS), pre-treated with SFN (5 µM, 6 h), and subsequently subjected to actinomycin D (5 µg/mL) or sustained SFN (5 µM) at the indicated time points. The graph depicts the natural logarithm of the relative levels of the Tek mRNA as a function of actinomycin D or actinomycin D/SFN incubation time, normalized to the geometric mean of the levels of Gapdh , Tbp , and Actb . The mRNA half-life was determined using the linear part of the degradation curve. Data are mean ± S.D. (n = 3). No statistically significant differences ( p ≤ 0.05) were detected between vehicle- and SFN-treated groups at any of the analyzed time points according to a two-way ANOVA followed by a Bonferroni post hoc test. ( B ) Representative immunoblots of NRF2 (arrowhead) and TIE2, as well as VCL as a loading control, from bEnd.3 were maintained under low-serum conditions (16 h, 1% FBS), pre-treated with SFN (5 µM, 6 h), and subsequently subjected to CHX (100 µM) or sustained SFN (5 µM) at the indicated time points. ( C ) The graph depicts the natural logarithm of the relative levels of the TIE2 protein as a function of CHX or CHX/SFN incubation time from representative immunoblots of A normalized to VCL. The protein half-life was determined using the linear part of the degradation curve. Data are mean ± S.D. (n = 3). No statistically significant differences ( p ≤ 0.05) were detected between vehicle- and SFN-treated groups at any of the analyzed time points according to a two-way ANOVA followed by a Bonferroni post hoc test. ( D ) bEnd.3 cells were transduced with lentiviral vectors carrying overexpressed NRF2 insensitive to KEAP1 degradation (NRF2 ∆ETGE ) or a lentivirus empty vector. Five days post-transduction, cells were maintained under low-serum conditions (16 h, 1% FBS). Chromatin immunoprecipitation (ChIP) analysis was performed with anti-IgG or anti-PolII antibodies, and the potential AREs in Tek with the highest were analyzed by qRT-PCR. The figure shows representative data normalized as the fold of enrichment with the anti-PolII antibody vs. the IgG antibody. The presence of already known AREs in Hmox1 (ARE1), Hmox1 (ARE2), and Nqo1 was analyzed as a positive control, and Actb was amplified as a negative control.

Article Snippet: Lentiviral vector pLKO.1 shRNA control (shCtrl) (Addgene Plasmid #10879) was purchased from Addgene; pLKO-puro shNRF2 (NM_010902) was purchased from Sigma-Aldrich.

Techniques: Incubation, Western Blot, Control, Transduction, Plasmid Preparation, Chromatin Immunoprecipitation, Quantitative RT-PCR, Positive Control, Amplification, Negative Control

a, Barplot of Annexin V + cells (%) in early and late apoptotic phase (EA - LA) detected by flow cytometry with Annexin V-APC staining and PI counterstain, in DAOY, UW228 and ONS76 in control or AMBRA1-depleted condition (n=3). b , Scatter plot distribution of Chronos corrected GeneEffect of CRISPR KO over mRNA expression in ONS76 cell line from DepMap. c , ( Left panel ) IB for the indicated proteins of whole-cell extracts from control ( shCTRL ) or p53 constitutively downregulated ONS76 cells in scramble or AMBRA1-depleted ( shp53 ). 24 hrs before harvesting cells were treated without or with 200 nM AZD7762 (n=3). ( Right panel ) Barplot of γH2AX normalized protein levels observed in c (n=3). d , IB for the indicated proteins of whole-cell extracts from control (shCTRL) or p53 constitutively downregulated ONS76 cells in scramble or AMBRA1-depleted. 24 hrs before harvesting cells were treated with or without 200 nM AZD7762 (n=3) . e , Boxplot of cell number from shCTRL or shp53 ONS76 cells in a scramble or AMBRA1-depleted condition. f , ( Left panel ) Scatter plot distribution of Chronos corrected GeneEffect of CRISPR KO for AMBRA1 and TP53 from 24Q4 DepMap release; MB cell lines in red. ( Right panel ) Table with Top6 co-dependent gene with AMBRA1. g , Boxplot for mRNA log2 expression of AMBRA1 in the different SHH subgroups derived from the publicly available dataset Cavalli (763 patients, fpkm normalized, mb500rs1 chip). SHH-α = 65; SHH-β = 35; SHH-Δ = 76; SHH-γ = 47. h , A comprehensive model illustrating how reduced AMBRA1 levels lead to the accumulation of RS. Data were analyzed using either with two-way ANOVA ( a ), or one-way ANOVA ( b , e ) Welch’s two-tailed unpaired t-test ( g )

Journal: bioRxiv

Article Title: Ubiquitin-dependent degradation of p21 Waf1/Cip1 is mediated by AMBRA1 to limit DNA replication stress

doi: 10.1101/2025.07.28.666126

Figure Lengend Snippet: a, Barplot of Annexin V + cells (%) in early and late apoptotic phase (EA - LA) detected by flow cytometry with Annexin V-APC staining and PI counterstain, in DAOY, UW228 and ONS76 in control or AMBRA1-depleted condition (n=3). b , Scatter plot distribution of Chronos corrected GeneEffect of CRISPR KO over mRNA expression in ONS76 cell line from DepMap. c , ( Left panel ) IB for the indicated proteins of whole-cell extracts from control ( shCTRL ) or p53 constitutively downregulated ONS76 cells in scramble or AMBRA1-depleted ( shp53 ). 24 hrs before harvesting cells were treated without or with 200 nM AZD7762 (n=3). ( Right panel ) Barplot of γH2AX normalized protein levels observed in c (n=3). d , IB for the indicated proteins of whole-cell extracts from control (shCTRL) or p53 constitutively downregulated ONS76 cells in scramble or AMBRA1-depleted. 24 hrs before harvesting cells were treated with or without 200 nM AZD7762 (n=3) . e , Boxplot of cell number from shCTRL or shp53 ONS76 cells in a scramble or AMBRA1-depleted condition. f , ( Left panel ) Scatter plot distribution of Chronos corrected GeneEffect of CRISPR KO for AMBRA1 and TP53 from 24Q4 DepMap release; MB cell lines in red. ( Right panel ) Table with Top6 co-dependent gene with AMBRA1. g , Boxplot for mRNA log2 expression of AMBRA1 in the different SHH subgroups derived from the publicly available dataset Cavalli (763 patients, fpkm normalized, mb500rs1 chip). SHH-α = 65; SHH-β = 35; SHH-Δ = 76; SHH-γ = 47. h , A comprehensive model illustrating how reduced AMBRA1 levels lead to the accumulation of RS. Data were analyzed using either with two-way ANOVA ( a ), or one-way ANOVA ( b , e ) Welch’s two-tailed unpaired t-test ( g )

Article Snippet: The following plasmids were used to generate the ONS76 shCTR and shp53 stable cell line: pLKO.1-puro – CMV - TurboG (Sigma-Aldrich) and pLKO.1 - puro - shp53 (Addgene #19119), a gift from Bob Weinberg. siRNA transfections were carried out using Lipofectamine RNAiMAX (Invitrogen) as described by the manufacturer.

Techniques: Flow Cytometry, Staining, Control, CRISPR, Expressing, Derivative Assay, Two Tailed Test